Haplogroup I-M170

Haplogroup I-M170
Possible time of origin Present 31-35,000 years BP
Possible place of origin Europe or Western Eurasia
Ancestor IJ
Descendants I*, I1, I2
Defining mutations L41, M170, M258, P19_1, P19_2, P19_3, P19_4, P19_5, P38, P212, U179

Haplogroup I (M170) is a Y-chromosome DNA haplogroup. It is a subgroup of haplogroup IJ, which itself is a derivative of the haplogroup IJK. I-M170 is one of the most numerous haplogroups among European males.[1] It can be found in most present-day European populations, with peaks in some Northern European and Southeastern European countries. Consequently, the haplogroup represents up to one-fifth of the male population of Europe, being the continent's second major Y-DNA haplogroup behind Haplogroup R. Haplogroup I-M170 Y-chromosomes have also been found among some populations of the Near East and Caucasus, Northeast Africa, America and Siberia. The haplogroup reaches its maximum frequency in the Dinaric Alps (with the highest concentration in present-day Herzegovina), where the men are on record as being the tallest in the world, with a male average height of 185.6 cm (6 ft 1.1 in).[2]

An European point of origin for I-M170 is generally proposed as it is not found outside of Europe on Paleolithic remains. However, the discovery in 2012 of living examples of Haplogroup IJ* in Mazanderani from Iran and Persians from Fars, may indicate that IJ originated in Near East.[3]

Origins

Spread of Cro-Magnons
European LGM refuges, 20 kya.
  Solutrean and Proto-Solutrean Cultures
  Epi-Gravettian Culture

Haplogroup IJ, carried by the Cro-Magnons was in the Middle East and/or Europe about 40,000 years ago. The TMRCA (time to most recent common ancestor) for the I clade was estimated by Karafet and colleagues in 2008 as 22.2 k.a. (22,200 years ago) with a confidence interval between 15.3-30.0 ka.,[4] placing the Haplogroup I-M170 founding event approximately contemporaneous with the Last Glacial Maximum (LGM) which lasted from 26.5 ka to 19 or 20 ka.[5] The TMRCA is an estimate of the time of subclade divergence. Rootsi and colleagues in 2004 also note two other dates for a clade, age of STR variation, and time since population divergence. These last two dates are roughly associated, and occur somewhat after subclade divergence. For Haplogroup I-M170 they estimate time to STR variation as 24±7.1 ky and time to population divergence as 23±7.7 ky.[6] These estimates are consistent with those of Karafet 2008 cited above. However Underhill and his colleagues calculate the time to subclade divergence of I1 and I2 to be 28.4±5.1 ky, though they calculate the STR variation age of I1 at only 8.1±1.5 kya.[7]

Semino (2000) speculated that the initial dispersion of this population corresponds to the diffusion of the Gravettian culture.[8] Later the haplogroup, along with two cases of Haplogroup C, was found on human remains belonging to the culture and on individuals of the Magdalenian and Azilian cultures.[9] Rootsi and colleagues in 2004 suggested that each of the ancestral populations now dominated by a particular subclade of Haplogroup I-M170 experienced an independent population expansion immediately after the last glacial maximum.[6]

In 2016, the 31,210-34,580 year old remains of a hunter gatherer from Paglicci was found with haplogroup I.[10] So far, only the ancestor of I Haplogroup F and Haplogroup C1b have been documented once each on older remains in Europe. The five known cases of haplogroup I from Paleolithic European human remains make it the most frequent haplogroup from that period.[9] The leading frequency of I remains on Mesolithic European remains until ca. 6000 BC. Due to the arrival of the Early Farmers I is outnumbered by Haplogroup G representatives on Neolithic European remains and by Haplogroup R on later remains. The earliest documentation of I1 is from Neolithic Hungary, although it must have separated from I2 longer ago. An instance, on which haplogroup I was found outside of Europe was at 2,000 year old remains from Mongolia.[11]

As of 2015 researches, the earliest light eyes and light hair of hominid (Homo Sapiens) individuals after the long extinct Neandarthals have been documented at 8,000 years old remains in Motala, Sweden, belonging to subclades of Haplogroup I2 and mitochondrial Haplogroup U5.[12][13][14] An I2a1 carrier was a carrier of red hair and others of genes of blond/light hair, while all the Mortala hunter-gatherers were light skinned and blue eyed males. However, 8-9,000 years old R1a remains from Karelia belonged to a light skinned male, while 17,000 years old light skin genes have been found in Siberia on a Haplogroup R carrier.

It would seem to be that separate waves of population movement impacted Southeastern Europe. The role of the Balkans as a long-standing corridor to Europe from Southwestern Asia is shown by the phylogenetic origins of Haplogroups I and J in the parent haplogroup IJ and the M429 mutation. This common ancestry suggests that subclades of the ancestral Haplogroup IJ-M429 probably entered Europe through the Balkans sometime before the Last Glacial Maximum. I and J were subsequently distributed in Asia and Europe in a disjunctive phylogeographic pattern typical of "sibling" haplogroups. A natural geographical corridor like the Balkans is likely to have been used later by members of other subclades of IJ, as well as other haplogroups, including Early European Farmer.

The discovery of Haplogroup IJK – the ancestor of both haplogroups IJ and K (M9) – and its evolutionary distance from other subclades of Haplogroup F (M89), supports the inference that both IJ-M429 and K-M9 arose in Southwestern Asia. Living carriers of F-M89* and IJ-M429* have been reported in the Iranian plateau.[3]

Haplogroups in Europe

Distribution

Frequencies of Haplogroup I:

Population % hg I % hg I (Subpopulation) Sampled individuals Source
Abkhazians33 12 Nasidze Ivan 2004[15]
Abkhazians3 162 Sergeevich 2007[16]
Adygei5 154 Kutuev 2007[17]
Afghanistan 3 (Hazara people) 60 El Sibai 2009[18]
Afghanistan 3 (Hazara), 2 (Tajiks), 0 (Pashtuns), 0 (Uzbeks), 0 (Turkmens) Di Cristofaro 2013[19]
Albanians 13 (Albania) 223 Sarno 2015
Albanians 26 (Tosk), 9 (Gheg) Ferri 2010
Albanians 22 (Tirana) 55 Battaglia 2008
Albanians 17 (Tirana) 30 Bosch 2006
Algerians 0 156 [20]
Andis27
Armenians 5 FTDNA 2013[21]
Avars2 115 Balanovsky
Austrians 28 50 (Vienna), 29 (Graz), 6 (Tyrol) [22]
Ashkenazi 1 1099 [23]
Azeri3 72 Nasidze Ivan 2004
Balkars3 135 Kutuev 2007[17]
Belarusians 23 11 (West), 15 (North), 16 (East), 28 (Centre), 30 (East Polesie), 34 (West Polesie) 565 Kushniarevich 2013
Belarusians 32 Polesie- 43 (Vichin), 12 (Avtyuki) 204 Sergeevich 2015 [24]
Bosnia and Herzegovina 53 73 (Croats), 49 (Bosniaks), 33 (Serbs) 256 Marjanovic 2006[25]
Bosnia and Herzegovina 65 Herzegovina- 71 (Mostar, Siroki Brijeg), Bosnia- 54 (Zenica) 210 Pericic 2005[26]
Bosnia and Herzegovina 73 (Croats), 45 (Bosniaks), 36 (Serbs) 255 Battaglia 2008[27]
Bulgarians 27-29 40 (Varna), 32 (Sofia), 30 (Plovdiv), 10 (Haskovo) 935Karachanak 2009-13[28][29]
Bulgarians 34 100 Begona Martinez-Cruz 2012
Bulgaria 19 (Bulgarian Turks) 63 Zaharova 2002[30]
Central Asia 2 984 Rootsi 2004
Chechens0 330 Balanovsky
Circassians2 126 Sergeevich 2007[16]
Croats 46 1100 Mrsic 2012
Croats 44 28 (Osijek) 89 Battaglia 2008[27]
Croats 66 (Hvar),54 (Korcula), 55 (Brac), 28 (Krk) Barac 2003[31]
Cyprus 1 164 El-Sibai 2009[32]
Czechs 18 25 (Klatovy), 25 (Pisek), 15 (Brno) 14 (Hradec), 10 (Trebic) 257 Luca 2007[33]
Danes 39 194 Rootsi 2004
Darginians58 26 Nasidze Ivan 2004
Darginians0 101
Dutch33 410 Van Doorn 2008[34]
Egyptians 0 124 El-Sibai 2009[35]
Egyptians 1 370 [36]
Estonians 19 194 Rootsi 2004
English 18 945 Rootsi 2004
English 26 12 (Cornwall), 38 (Essex) 1830 FTDNA 2016[37]
Estonians17 118 Lappalainen 2008[38]
Flemish Belgians 28 113 [39]
Finland 29 52 (Satakunta), 47 (Ostrobothnia), 36 (Swedes from Ostrobothnia), 15 (Northern Savo) 536 Lappalainen 2008[40]
French 16 (South), 24 (Normandy), 4 (Lyon) , 4 (Corsica) Rootsi 2004
French 9 5 (Auvergne), 13 (Brittany), 9 (Nord Pas de Calais) 555 Luis-Ramos 2008[41]
French 13 11 (Paris), 18 (Strasburg), 10 (Lyon) 333 Kari Hauhio[22]
Gagauzes28 89 Varzari 2006
Georgians 0 63 Rootsi 2004
Georgians4 77 Nasidze Ivan 2004
Germans 24 32 (Berlin), 32 (Hamburg), 15 (Leipzig) 1215 Kayser 2005[42]
Greeks 14 30 (Macedonia) 261 Rootsi 2004
Greeks 10 (Athens), 30 (Macedonia) 149 Battaglia 2008
Greeks36 (Serres), 24 (Agrinio), 20 (Thessaloniki), 18 (Mytilene), 14 (Crete), 14 (Larissa), 11 (Patrai), 12 (Karditsa), 8 (Ioannina), 2 (Chios) 366 Di Giacommo 2003[43]
Greeks 12 (North), 24 (South) 142 Zalloua 2008
Greenlanders 17 215 Sanchez 2004[44]
Hungarians 23 162 Rootsi 2004
Hungarians 28 230 Vago Zalan Andrea 2008
Indians 0 (North India) 560 [45]
Ingush0 143
Iranians 2 22 (South Iran), 5 (Khorasan), 0 (Teheran) 186 Di Cristofaro 2013[19]
Iranians 1 (West), 1 (East) 324 [46]
Iranians 0 83 Rootsi 2004
Iranians 1 92 El-Sibai 2009[47]
Iranians 0 6 (Armenians of Teheran), 0 (Persians of Teheran, Fars, Isfahan, Khorasan, Yazd) 952 Grugni 2012
Iraqis 1 176 Rootsi 2004[48]
Iraqis 1 117 El-Sibai 2009[49]
Irish 11 76 Rootsi 2004
Irish 10 119 Cappeli 2013[50]
Irish 11 (Rush, Dublin) Capelli 2003
Italians 5 (North), 7 (Central), 9 (Sicily), 39 (Sardinia) Rootsi 2004
Italians 10 31 (Sardinia), 4 (Umbria, Marche) 884 Boattini 2013[51]
Italians 7 0 (Calabria, Pescara, Garfognana, Val di Non), 5 (Verona), 7(Genoa), 19 (Foggia) 524 Di Giacommo 2003[52]
Italians 36 (Filettino) 35 (Cappadocia, Abruzzo), 28 (Vallepietra) Messina 2015[53]
Italians 23 (Udine), 17 (Saniti), 13 (Picenium), 7 (Latini) 583 Brisighelli 2012[54]
Italians 30 (Stelvio) [55]
Italians 31 (Caccamo) Gaetano 2008[56]
Jordanians 1 273 El-Sibai 2009[57]
Jordanians 5 (Amman), 0 (Dead Sea) 146 Flores 2005[58]
Kabardians4 140 Kutuev 2007[17]
Kara Nogays13 76
Karchays9 69 Sergeevich 2007[16]
Kazakhs 1 370 [59]
Kosovar Albanians 8 114 Pericic 2005
Kumyks0 73 Kutuev 2007[17]
Kurds 4 (West Iran) 21 Malyarchuk 2013[60]
Kurds 2 (Iran) 59 Gragni 2012
Kurmanji 17 (Turkey), 0 (Georgia) 112 Nasidze 2005[61]
Kuwaiti 0 42 El-Sibai 2009[62]
Kyrgyzstan 0 (Uyghurs), 0 (Kyrgyz) Di Cristofaro 2013[19]
Laks 14 [63]
Latvians 9 3 (Southwest) [64]
Lebanese 3 10 (North Marionite), 0 (Shia) 951 [65][66]
Lebanese 5 66 Rootsi 2004
Lezgis0 81
Lithuanians 7 Kushniarevich 2015
Libyans 0 83 [67]
Libyans 2 1 175 Fendri 2015[68]
Macedonians34 (Skopje) 79 Pericic 2005
Macedonia24 31 (Macedonians), 12 (Albanians) 343 Noevski 2010
Macedonia 13 (Albanians) 64 Battaglia 2008[27]
Maltese 12 90 El-Sibai 2009[69]
Moldovans 29 (Moldovans), 25 (Ukrainians) Varzari 2006
Moroccans 0 316 El-Sibai 2009[70]
Moroccans 0 760 [71]
Mongols 1 160 Di Cristofaro 2013[19]
Norwegians45 906 FTDNA[72]
Norwegians37 40 (Oslo) 30 (West), 42 (East, South), 35 (North), 33 (Bergen) Dupuy 2005
Pakistan0 638 [73]
Poles17 19 (Warsaw), 12 (Lublin), 22 (Szczecin) 913 Kayser 2005
Poles 18 191 Rootsi 2004
Portuguese 5 303 Rootsi 2004
Portuguese 8 3 (Lisboa), 0 (Setubal), 18 (Braga) 657 Beleza 2005[74]
Qatar 0 72 El-Sibai 2009[75]
Romani 17 (Hungary), 10 (Tiszavasvari), 5 (Tokaj) 37 (Taktakoz), 11 (Slovakia) Vago Zalan Andrea 2008
Romanians 28 36 (Brasov), 18 (Cluj) 178 Martinez-Cruz 2012[76]
Romanians 22 361 Rootsi 2004
Russians 13 (North Europe), 18 (Centre Europe), 21 (South Europe), 27 (Unzha), 0 (Mezen) 1228 Balanovsky 2008
Russia 2 (Udmurts), 5 (Pinega), 5 (Komi), 5 (Tatars), 6 (Bashkortostan), 19 (Kostroma), 11 (Chuvashes), 11 (Smolensk), 17 (Belgorod), 19 (Mordvins), 23 (Cossacks), 24 (Adygea) Rootsi 2004
Saami 31 Rootsi 2004
Saudis 0 1597 [77]
Scotland 11 17 (Scottish Isles) Rootsi 2004
Sephardi 4 (Portugal) 57 [78]
Serbians 36 (Belgrade) 113 Pericic2005[26]
Serbians 41 (Aleksandrovac) 85
Serbians 39 267 Todorovic 2013[79]
Slovakians 28 250 Petrejcikova 2013[80]
Slovenians 30 57 (Spodnjeposavska) 458 Vakar 2010[81]
Spaniards 6 18 (Asturias), 0 (Gascony) 1002 Adams 2008[82]
Sudanese 5 (Nubians), 4 (Gaalien), 7 (Mesereia) [83]
Swedes 4232 (Ostergotaland & Jonkoping) 50 (Gotland & Varmland) 305 Karlsson2006[84]
Swedes 26 (North Sweden),[85] Rootsi2004
Swedes 41 (South), 26 (North) Rootsi 2004
Swedes 44 60 (Kristianstad), 60 (Kalmar), 59 (Kronoberg), 55 (Stockholm), 37 (North Norrland), 52 (South Norrland) 1800 FTDNA 2016[86]
Swiss 8 144 Rootsi 2004
Swiss 23 13 (Lausanne), 32 (Bern) [22]
Syrians 2 (West), 3 (East) 520 [87]
Syrians 2 554 El Sibai 2009[88]
Tataers 33 (China) 33 [89]
Tunisians 0 El-Sibai 2009[90]
Tunisians 0 601 [91]
Turks 5 12 (Marmara), 10 (Istanbul), 7 (Western Anatolia), 4 (Central Anatolia), 0 (Eastern Anatolia ) 523 Cinnioglu 2003
Turks 5 741 Rootsi 2004
UAE 0 164 El-Sibai 2009[92]
Ukrainians 22 585 Rootsi 2004
Ukrainians 28 33 (Sumy), 23 (Ivano-Frankivsk) 701 Kushniarevich 2013
Welsh 8 196 Rootsi 2004
Yemenese 0 62 El-Sibai 2009[93]
Zazas 33 (Turkey) 27 Nasidze 2005[94]
17 (Albanians in Tirana), 29 (Macedonians in Skopje), 21 (Aromanians in Krusevo), 19 (Greeks in Thrace), 42 (Aromanians in Andon Poci), 42 (Romanians in Constanta), 39 (Romanians in Piotesti) Bosch 2006[95]
47 (Romanians from Buhusi and Piatra-Neamt), 35 (Moldovans from Sofia), 24 (Moldovans from Karasahani) 24 (Gagauzes from Etulia), 31 (Gagauzes from Kongaz), 25 (Ukrainians from Rashkovo) Vazari 2006
38 (Sweden), 41 (Western Finland), 28 (Eastern Finland), 18 (Karelia), 12 (Lithuania), 7 (Latvia), 17 (Estonia) Lappalainen2008[96]
34 (Iranians from Teheran), 10 (Iranians from Isfahan), 32 (Ossetians from Ardon), 13 (Ossetians from Digora) Nasidze Ivan. 2004[15]
3 (Tajiks) 3 (East Persians) Malyarchuk 2013[97]
2 (Kizhi), 4 (Teleuts), 4 (Khakassians), 3 (Todjins), 2 (Evenks) 3 (Tofalars), 1 (Tuvinians)

Subgroups

The subclades of Haplogroup I-M170 with their defining mutations:[98]

Note that the naming of some of the subgroups has changed, as new markers have been identified, and the sequence of mutations has become clearer..

I-M170

The composite subclade I-M170 contains individuals directly descended from the earliest members of Haplogroup I, bearing none of the subsequent mutations which identify the remaining named subclades.

Several haplogroup I*-M170 individuals who do not fall in known subclades, with some of the greatest Y-STR diversity, have significantly been found among the populations of Turkey (8/741), Adygea (2/138), and Iraq (1/176),even though as a whole Haplogroup I-M170 occurs at only very low frequencies among modern populations of the Middle East and Caucasus. This is consistent with the belief that the haplogroup first appeared in that region. Overall, the highest frequencies of Haplogroup I*-M170 appear to be found among the Andalusians (3/103), French (4/179), Slovenians (2/55), Tabassarans (1/30)[101] and the Saami (1/35). The greatest figure so far for I* was among the Laks in Dagestan, at a rate of (3/21).[101]

Neither study from which the previous figures were drawn excluded the present I2-M438 clade as a whole, but only certain subclades, so this I* may or may not belong to I2. A single Hazara from Afghanistan was found to carry I* excluding both I1-M253 and I2-M438.[102]

I1-M253

Main article: Haplogroup I1 (Y-DNA)

Haplogroup I1-M253 (M253, M307, P30, P40) displays a very clear frequency gradient, with a peak frequency of approximately 35% among the populations of southern Norway, southwestern Sweden, and Denmark, and rapidly decreasing frequencies toward the edges of the historically Germanic-influenced world. A notable exception is Finland, where frequency in West Finns is up to 40%, and in certain provinces like Satakunta more than 50%.

Outside Fennoscandia, distribution of Haplogroup I1-M253 is closely correlated with that of Haplogroup I2a2-M436; but among Scandinavians (including both Germanic and Uralic peoples of the region) nearly all the Haplogroup I-M170 Y-chromosomes are I1-M253. Another characteristic of the Scandinavian I1-M253 Y-chromosomes is their rather low haplotype diversity (STR diversity): a greater variety of Haplogroup I1-M253 Y-chromosomes has been found among the French and Italians, despite the much lower overall frequency of Haplogroup I1-M253 among the modern French and Italian populations.

I2-M438

Main article: Haplogroup I-M438

Haplogroup I2-M438, previously I1b, may have originated in southern Europe – it is now found at its highest frequencies in the western Balkans and Sardinia – some 15,000–17,000 years ago and developed into three main subgroups : I2-M438*, I2a-L460, I2b-L415 and I2c-L596.

I2a1a-M26


Haplogroup I2a1a-M26 is notable for its strong presence in Sardinia. Haplogroup I-M170 comprises approximately 40% of all patrilines among the Sardinians, and I2a1a-M26 is the predominant type of I among them.

Haplogroup I2a1a-M26 is practically absent east of France and Italy,[103] while it is found at low but significant frequencies outside of Sardinia in the Balearic Islands, Castile-León, the Basque Country, the Pyrenees, southern and western France, and parts of the Maghreb in North Africa, Great Britain, and Ireland. Haplogroup I2a1a-M26 appears to be the only subclade of Haplogroup I-M170 found among the Basques, but appears to be found at somewhat higher frequencies among the general populations of Castile-León in Spain and Béarn in France than among the population of ethnic Basques. The M26 mutation is found in native males inhabiting every geographic region where megaliths may be found, including such far-flung and culturally disconnected regions as the Canary Islands, the Balearic Isles, Corsica, Ireland, and Sweden.[103]

The distribution of I2a1a-M26 also mirrors that of the Atlantic Bronze Age cultures, which indicates a potential spread via the obsidian trade or a regular maritime exchange of some of metallurgical products.[103]

I2a1b-M423

Haplogroup I2a1b-M423 is the most frequent Y-chromosome Haplogroup I-M170 in Central and Eastern European populations, reaching its peak in the Western Balkans, most notably in Dalmatia (50-60%[26]) and Bosnia-Herzegovina (up to 71%,[104] avg. 40-50%[26]). A greater variance of this group has been found in Ireland and Great Britain, but overall frequency is very low (2-3%). Haplogroup I2a1b-M423 is virtually absent in Fennoscandia, Western and Southwestern Europe.

I2a2-M436

The distribution of Haplogroup I2a2-M436 (M436/P214/S33, P216/S30, P217/S23, P218/S32) is closely correlated to that of Haplogroup I1 except in Fennoscandia, which suggests that it was probably harbored by at least one of the Paleolithic refuge populations that also harbored Haplogroup I1-M253; the lack of correlation between the distributions of I1-M253 and I2a2-M436 in Fennoscandia may be a result of Haplogroup I2a2-M436's being more strongly affected in the earliest settlement of this region by founder effects and genetic drift due to its rarity, as Haplogroup I2a2-M436 comprises less than 10% of the total Y-chromosome diversity of all populations outside of Lower Saxony. Haplogroup I2a2-M436 has been found in over 4% of the population only in Germany, the Netherlands, Belgium, Denmark, England (not including Cornwall), Scotland, and the southern tips of Sweden and Norway in Northwest Europe; the provinces of Normandy, Maine, Anjou, and Perche in northwestern France; the province of Provence in southeastern France; the regions of Tuscany, Umbria, and Latium in Italy; and Moldavia and the area around Russia's Ryazan Oblast and Republic of Mordovia in Eastern Europe. One subclade of Haplogroup I2a2-M436, namely I2a2a1a1-M284, has been found almost exclusively among the population of Great Britain, which has been taken to suggest that the clade may have a very long history in that island. It is notable, however, that the distributions of Haplogroup I1-M253 and Haplogroup I2a2-M436 seem to correlate fairly well with the extent of historical influence of Germanic peoples. The punctual presence of both haplogroups at a low frequency in the area of the historical regions of Bithynia and Galatia in Turkey may be related to the Varangian Guard or rather suggests a connection with the ancient Gauls of Thrace, several tribes of which are recorded to have immigrated to those parts of Anatolia at the invitation of Nicomedes I of Bithynia. This suggestion is supported by recent genetic studies regarding Y-DNA Haplogroup I2b2-L38 have concluded that there was some Late Iron Age migration of Celtic La Tène people, through Belgium, to the British Isles including north-east Ireland.[105]

Haplogroup I2a2-M436 also occurs among approximately 1% of Sardinians, and in Hazaras from Afghanistan at 3%.[106]

Specifications of mutation

The technical details of U179 are:

Nucleotide change (rs2319818): G to A
Position (base pair): 275
Total size (base pairs): 220
Forward 5′→ 3′: aaggggatatgacgactgatt
Reverse 5′→ 3′: cagctcctcttttcaactctca

See also

References

  1. ↑ http://www.cell.com/ajhg/abstract/S0002-9297(07)62002-3?cc=y
  2. ↑ Pineau, JC; Delamarche, P; Bozinovic, S (2012-05-24). "Average height of adolescents in the Dinaric Alps. They are also reputed to have the tallest males in Europe. Study claims it is not complete as yet". C. R. Biol. 328: 841–6. doi:10.1016/j.crvi.2005.07.004. PMID 16168365.
  3. 1 2 Grugni (2012). "Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians". PLOS ONE. 7: e41252. doi:10.1371/journal.pone.0041252. PMC 3399854Freely accessible. PMID 22815981.
  4. ↑ Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–8. doi:10.1101/gr.7172008. PMC 2336805Freely accessible. PMID 18385274.
  5. ↑ Clark PU, Dyke AS, Shakun JD, et al. (August 2009). "The Last Glacial Maximum". Science. 325 (5941): 710–4. doi:10.1126/science.1172873. PMID 19661421. Retrieved 2010-01-27.
  6. 1 2 Rootsi Siiri; Kivisild, Toomas; Benuzzi, Giorgia; Help, Hela; Bermisheva, Marina; Kutuev, Ildus; Barać, Lovorka; Peričić, Marijana; Balanovsky, Oleg; Pshenichnov, Andrey; Dion, Daniel; Grobei, Monica; Zhivotovsky, Lev A.; Battaglia, Vincenza; Achilli, Alessandro; Al-Zahery, Nadia; Parik, Jüri; King, Roy; Cinnioğlu, Cengiz; Khusnutdinova, Elsa; Rudan, Pavao; Balanovska, Elena; Scheffrahn, Wolfgang; Simonescu, Maya; Brehm, Antonio; Goncalves, Rita; Rosa, Alexandra; Moisan, Jean-Paul; Chaventre, Andre; et al. (2004). ", Phylogeography of Y-Chromosome Haplogroup I-M170 Reveals Distinct Domains of Prehistoric Gene Flow in Europe". American Journal of Human Genetics. 75 (1): 128–137. doi:10.1086/422196. PMC 1181996Freely accessible. PMID 15162323.
  7. ↑ P.A. Underhill, N.M. Myres, S. Rootsi, C.T. Chow, A.A. Lin, R.P. Otillar, R. King, L.A. Zhivotovsky, O. Balanovsky, A. Pshenichnov, K.H. Ritchie, L.L. Cavalli-Sforza, T. Kivisild, R. Villems, S.R. Woodward, New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in P. Mellars, K. Boyle, O. Bar-Yosef and C. Stringer (eds.), Rethinking the Human Evolution (2007), pp. pp. 33-42.
  8. ↑ Semino O, Passarino G, Oefner PJ, et al. (November 2000). "The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective". Science. 290 (5494): 1155–9. doi:10.1126/science.290.5494.1155. PMID 11073453.
  9. 1 2 "Palaeolithic DNA from Eurasia". Retrieved 5 October 2016.
  10. ↑ Qiaomei Fu et al, The genetic history of Ice Age Europe, Nature(2016)doi:10.1038/nature17993Received 18 December 2015 Accepted 12 April 2016 Published online 02 May 2016
  11. ↑ . doi:10.1086/377005 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1180365/table/TB2/. Missing or empty |title= (help)
  12. ↑ "White Skin Developed in Europe Only As Recently as 8,000 Years Ago Say Anthropologists".
  13. ↑ "Ancient Hirisplex".
  14. ↑ "Phenotype SNPs from prehistoric Europe".
  15. 1 2 Nasidze Ivan; Ling, E. Y. S.; Quinque, D.; Dupanloup, I.; Cordaux, R.; Rychkov, S.; Naumova, O.; Zhukova, O.; Sarraf-Zadegan, N.; Naderi, G. A.; Asgary, S.; Sardas, S.; Farhud, D. D.; Sarkisian, T.; Asadov, C.; Kerimov, A.; Stoneking, M.; et al. (2004). ", Mitochondrial DNA and Y-Chromosome Variation in the Caucasus" (PDF). Annals of Human Genetics. 68 (Pt 3): 205–221. PMID 15180701.
  16. 1 2 3 ИЗУЧЕНИЕ ГЕНЕТИЧЕСКОЙ СТРУКТУРЫ НАРОДОВ ЗАПАДНОГО КАВКАЗА ПО ДАННЫМ О ПОЛИМОРФИЗМЕ Y-ХРОМОСОМЫ, МИТОХОНДРИАЛЬНОЙ ДНК И ALU-ИНСЕРЦИЙ
  17. 1 2 3 4 Кутуев Ильдус Альбертович. Генетическая структура и молекулярная филогеография народов кавказа
  18. ↑ doi.10.1371/journal.pone.0034288
  19. 1 2 3 4 Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge
  20. ↑ Introducing the Algerian Mitochondrial DNA and Y-Chromosome Profiles into the North African Landscape
  21. ↑ "Armenian DNA Project".
  22. 1 2 3
  23. ↑
  24. ↑ ВКЛАД ОТДЕЛЬНЫХ ПОЛЕССКИХ ПОПУЛЯЦИЙ И ПОПУЛЯЦИИ БЕЛОРУССКИХ ТАТАР В ГЕНОФОНД НАСЕЛЕНИЯ БЕЛАРУСИ
  25. ↑ Marjanovic 2006
  26. 1 2 3 4 Pericic M, Lauc LB, Klaric IM; et al. (October 2005). "High-resolution phylogenetic analysis of southeastern Europe traces major episodes of paternal gene flow among Slavic populations". Mol. Biol. Evol. 22 (10): 1964–75. doi:10.1093/molbev/msi185. PMID 15944443.
  27. 1 2 3 Battaglia, Vincenza; Fornarino, Simona; Al-Zahery, Nadia; Olivieri, Anna; Pala, Maria; Myres, Natalie M; King, Roy J; Rootsi, Siiri; et al. (24 December 2008). "Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe" (PDF). European Journal of Human Genetics. 17 (6): 820–30. doi:10.1038/ejhg.2008.249. PMC 2947100Freely accessible. PMID 19107149.
  28. ↑ Karachanak S, Fornarino S, Grugni V, Semino O, Toncheva D, Galabov A, Atanasov B (2009). "Y-Chromosomal Haplogroups in Bulgarians". Comptes rendus de l'Academie bulgare des Sciences. 62 (3): 393–400. ISSN 1310-1331. INIST:21359873.
  29. ↑ Karachanak S, Grugni V, Fornarino S, Nesheva D, Al-Zahery N, Battaglia V, et al. (2013). Pereira LM, ed. "Y-chromosome diversity in modern Bulgarians: new clues about their ancestry". PLoS ONE. 8 (3): e56779. Bibcode:2013PLoSO...856779K. doi:10.1371/journal.pone.0056779. PMC 3590186Freely accessible. PMID 23483890.
  30. ↑
  31. ↑ Barac L, Pericic M, Klaric IM; et al. (July 2003). "Y chromosomal heritage of Croatian population and its island isolates" (PDF). Eur. J. Hum. Genet. 11 (7): 535–42. doi:10.1038/sj.ejhg.5200992. PMID 12825075.
  32. ↑ Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast
  33. ↑ Y-chromosomal variation in the Czech Republic
  34. ↑ ZONEN VAN ADAM IN NEDERLAND Genetische genealogie : een zoektocht in ons DNA-archief
  35. ↑ Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast
  36. ↑ Introducing the Algerian Mitochondrial DNA and Y-Chromosome Profiles into the North African Landscape
  37. ↑ https://s-media-cache-ak0.pinimg.com/originals/d1/09/43/d109434a9e66aad55a8b10c4677dbba3.png
  38. ↑ Migration Eaves to the Baltic Region
  39. ↑ http://www.jogg.info/32/mertens.htm
  40. ↑ Regional differences among the Finns: A Y-chromosomal perspective
  41. ↑ Phylogeography of French male lineages
  42. ↑ "Significant genetic differentiation between Poland and Germany followspresent-day political borders, as revealed by Y-chromosome analysis".
  43. ↑ https://www.familytreedna.com/pdf/italy.pdf
  44. ↑ Y chromosome SNP haplogroups in Danes, Greenlanders and Somalis
  45. ↑ Presence of three different paternal lineages among North Indians: a study of 560 Y chromosomes (2009)
  46. ↑ Influences of history, geography, and religion on genetic structure: the Maronites in Lebanon
  47. ↑ Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast
  48. ↑ The Western and Eastern Roots of the Saami—the Story of Genetic “Outliers” Told by Mitochondrial DNA and Y Chromosomes
  49. ↑ Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast
  50. ↑ A Y Chromosome Census of the British Isles
  51. ↑ Uniparental Markers in Italy Reveal a Sex-Biased Genetic Structure and Different Historical Strata
  52. ↑ Clinal patterns of human Y chromosomal diversity in continental Italy and Greece are dominated by drift and founder effects
  53. ↑ Traces of forgotten historical events in mountain communities in Central Italy: A genetic insight
  54. ↑ Uniparental Markers of Contemporary Italian Population Reveals Details on Its Pre-Roman Heritage
  55. ↑ Genetic Structure in Contemporary South Tyrolean Isolated Populations Revealed by Analysis of Y-Chromosome, mtDNA, and Alu Polymorphisms
  56. ↑ Differential Greek and northern African migrations to Sicily are supported by genetic evidence from the Y chromosome
  57. ↑ Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast
  58. ↑ Isolates in a corridor of migrations: A high-resolution analysis of Y-chromosome variation in Jordan
  59. ↑ Вестник Московского университета. Серия XXIII АНТРОПОЛОГИЯ № 1/2014: 96–101СВЯЗЬ ИЗМЕНЧИВОСТИ Y ХРОМОСОМЫ И РОДОВОЙСТРУКТУРЫ: ГЕНОФОНД СТЕПНОЙ АРИСТОКРАТИИИ ДУХОВЕНСТВА КАЗАХОВ
  60. ↑ Y chromosomes in Iranians and Tajiks
  61. ↑ MtDNA and Y-chromosome Variation in Kurdish Groups
  62. ↑ Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast
  63. ↑ The dual origin of tati-speakers from dagestan as written in the genealogy of uniparental variants
  64. ↑ Pliss et. al. Y-Chromosomal Lineages of Latvians in the Contextof the Genetic Variation of the Eastern-Baltic Region
  65. ↑ Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast
  66. ↑ Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events
  67. ↑ Introducing the Algerian Mitochondrial DNA and Y-Chromosome Profiles into the North African Landscape
  68. ↑ Paternal lineages in Libya inferred from Y-chromosome haplogroups
  69. ↑ Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast
  70. ↑ Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast
  71. ↑ Introducing the Algerian Mitochondrial DNA and Y-Chromosome Profiles into the North African Landscape
  72. ↑ https://docs.google.com/spreadsheets/d/1YzT09-z3NodQSBcHNhcty6KQw6DQNLCKKaUZQTojIRA/edit#gid=1132979062
  73. ↑ Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan (2006)
  74. ↑ Micro-Phylogeographic and Demographic History of Portuguese Male Lineages
  75. ↑ Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast
  76. ↑ Martinez-Cruz B, Ioana M, Calafell F, Arauna LR, Sanz P, Ionescu R, et al. (2012). Kivisild T, ed. "Y-chromosome analysis in individuals bearing the Basarab name of the first dynasty of Wallachian kings". PLoS ONE. 7 (7): e41803. Bibcode:2012PLoSO...741803M. doi:10.1371/journal.pone.0041803. PMC 3404992Freely accessible. PMID 22848614.
  77. ↑ Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions.
  78. ↑ Phylogeographic analysis of paternal lineages in NE Portuguese Jewish communities
  79. ↑
  80. ↑ The genetic structure of the Slovak population revealed by Y-chromosome polymorphisms
  81. ↑ ANALIZA Y-DNK HAPLOTIPOV SLOVENCEV
  82. ↑ Adams et al. The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula
  83. ↑ Y-Chromosome Variation Among Sudanese: Restricted Gene Flow, Concordance With Language, Geography, and History
  84. ↑ Karlsson, Andreas O; Wallerstrom, Thomas; Gotherstrom, Anders; Holmlund, Gunilla (2006). "Y-chromosome diversity in Sweden – A long-time perspective". European Journal of Human Genetics. 14 (8): 963–970. doi:10.1038/sj.ejhg.5201651. PMID 16724001.
  85. ↑ Rootsi S, Magri C, Kivisild T, et al. (July 2004). "Phylogeography of Y-chromosome haplogroup I-M170 reveals distinct domains of prehistoric gene flow in europe". Am. J. Hum. Genet. 75 (1): 128–37. doi:10.1086/422196. PMC 1181996Freely accessible. PMID 15162323.
  86. ↑
  87. ↑ Influences of history, geography, and religion on genetic structure: the Maronites in Lebanon
  88. ↑ Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast
  89. ↑ Y-chromosome distributions among populations in Northwest China identify significant contribution from Central Asian pastoralists and lesser influence of western Eurasians (2010)
  90. ↑ Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast
  91. ↑ Introducing the Algerian Mitochondrial DNA and Y-Chromosome Profiles into the North African Landscape
  92. ↑ Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast
  93. ↑ Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast
  94. ↑ MtDNA and Y-chromosome Variation in Kurdish Groups
  95. ↑ Bosch, E.; Calafell, F.; Gonzalez-Neira, A.; Flaiz, C; Mateu, E; Scheil, HG; Huckenbeck, W; Efremovska, L; et al. (2006). "Paternal and maternal lineages in the Balkans show a homogeneous landscape over linguistic barriers, except for the isolated Aromuns". Annals of Human Genetics. 70 (Pt 4): 459–87. doi:10.1111/j.1469-1809.2005.00251.x. PMID 16759179.
  96. ↑ Lappalainen, T.; Laitinen, V.; Salmela, E.; Andersen, P.; Huoponen, K.; Savontaus, M.-L.; Lahermo, P. (May 2008). "Migration waves to the Baltic Sea region". Ann. Hum. Genet. 72 (Pt 3): 337–48. doi:10.1111/j.1469-1809.2007.00429.x. PMID 18294359.
  97. ↑ Y chromosomes in Iranians and Tajiks
  98. ↑ ISOGG 2011
  99. ↑ Cinniog˘lu, Cengiz et al 2003-04, Excavating Y-chromosome haplotype strata in Anatolia
  100. ↑ http://isogg.org/tree/ISOGG_HapgrpI.html
  101. 1 2 Bulayeva, Caciagli et al, 2009.http://vigg.academia.edu/KazimaBulayeva/Papers/125870/The_key_role_of_patrilineal_inheritance_in_shaping_the_genetic_variation_of_Dagestan_highlanders
  102. ↑ Cristofaro J, et al. (October 2013). "Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge". PLOS ONE. 8: e76748. doi:10.1371/journal.pone.0076748.
  103. 1 2 3 Rootsi; et al. "Phylogeography of Y-Chromosome Haplogroup I Reveals Distinct Domains of Prehistoric Gene Flow in Europe figure 1" (PDF).
  104. ↑ Marjanovic D, Fornarino S, Montagna S, et al. (November 2005). "The peopling of modern Bosnia-Herzegovina: Y-chromosome haplogroups in the three main ethnic groups". Ann. Hum. Genet. 69 (Pt 6): 757–63. doi:10.1111/j.1529-8817.2005.00190.x. PMID 16266413.
  105. ↑ McEvoy and Bradley, Brian P and Daniel G (2010). Celtic from the West Chapter 5: Irish Genetics and Celts. Oxbow Books, Oxford, UK. p. 117. ISBN 978-1-84217-410-4.
  106. ↑ Haber, Marc; Platt, Daniel E.; Ashrafian Bonab, Maziar; Youhanna, Sonia C.; Soria-Hernanz, David F.; Martínez-Cruz, Begoña; Douaihy, Bouchra; Ghassibe-Sabbagh, Michella; Rafatpanah, Hoshang; Ghanbari, Mohsen; Whale, John; Balanovsky, Oleg; Wells, R. Spencer; Comas, David; Tyler-Smith, Chris; Zalloua, Pierre A. (2012). "Afghanistan's ethnic groups share a Y-chromosomal heritage structured by historical events". PLOS ONE. 7 (3): e34288. doi:10.1371/journal.pone.0034288. PMC 3314501Freely accessible. PMID 22470552.
Notes

External links

Phylogenetic tree and distribution maps

Projects

Other

Phylogenetic tree of human Y-chromosome DNA haplogroups [χ 1][χ 2]
"Y-chromosomal Adam"
A00 A0-T [χ 3]
A0 A1 [χ 4]
A1a A1b
A1b1 BT
B CT
DE CF
D E C F
F1  F2  F3  GHIJK
G HIJK
IJK H
IJ   K
I J    LT [χ 5]  K2
L T [χ 6] NO [χ 7] K2b [χ 8]     K2c  K2d  K2e [χ 9]
N   O   K2b1 [χ 10]     P
K2b1a [χ 11]   K2b1b  K2b1c  M P1 P2
K2b1a1   K2b1a2   K2b1a3 S [χ 12] Q   R
  1. ↑ Van Oven M, Van Geystelen A, Kayser M, Decorte R, Larmuseau HD (2014). "Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome". Human Mutation. 35 (2): 187–91. doi:10.1002/humu.22468. PMID 24166809.
  2. ↑ International Society of Genetic Genealogy (ISOGG; 2015), Y-DNA Haplogroup Tree 2015. (Access date: 1 February 2015.)
  3. ↑ Haplogroup A0-T is also known as A0'1'2'3'4.
  4. ↑ Haplogroup A1 is also known as A1'2'3'4.
  5. ↑ Haplogroup LT (L298/P326) is also known as Haplogroup K1.
  6. ↑ Between 2002 and 2008, Haplogroup T (M184) was known as "Haplogroup K2" – that name has since been re-assigned to K-M526, the sibling of Haplogroup LT.
  7. ↑ Haplogroup NO (M214) is also known as Haplogroup K2a (although the present Haplogroup K2e was also previously known as "K2a").
  8. ↑ Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS.
  9. ↑ Haplogroup K2e (K-M147) was previously known as "Haplogroup X" and "K2a" (but is a sibling subclade of the present K2a, also known as Haplogroup NO).
  10. ↑ Haplogroup K2b1 (P397/P399) is similar to the former Haplogroup MS, but has a broader and more complex internal structure.
  11. ↑ Haplogroup K2b1a has also been known as Haplogroup S-P405.
  12. ↑ Haplogroup S (S-M230), also known as K2b1a4, was previously known as Haplogroup K5.
This article is issued from Wikipedia - version of the 11/19/2016. The text is available under the Creative Commons Attribution/Share Alike but additional terms may apply for the media files.